VƯỜN QUỐC GIA PHƯỚC BÌNH
Kết quả định danh bằng sinh học phân tử một số mẫu nấm thu được từ VQG Phước Bình dựa vào trình tự vùng ITS - rDNA

Kết quả định danh bằng sinh học phân tử một số mẫu nấm thu được

từ VQG Phước Bình dựa vào trình tự vùng ITS - rDNA

Hình 1: Các mẫu nấm thu thập từ VQG Phước Bình

Sau khi phân lập và tăng sinh trên môi trường lỏng (mẫu PB01, PB03, PB04) được ly trích DNA, DNA sẽ được sử dụng để khuếch đại vùng ITS-rDNA bằng phương pháp PCA ới primer ITS4 – ITS5.

Hình 2: Kết quả điện di sản phẩm PCR các mẫu nấm trên gel Agarose.

1.      Ladder

2.      PB01

3.      PB03

4.      PB04

Sản phẩm PCR với cặp mồi ITS4 – ITS5 sau khi điện di trên gel agarose có kích thước khoảng 700bp khi so sánh với thang DNA. Sản phẩm khuếch đại vùng ITS của 3 mẫu PB01, PB03, PB04 được giải trình tự và so sánh độ tương đồng với các trình tự nấm Linh chi đã được công bố trên GenBank.

1.      Trình tự ITS của mẫu PB01 được khuếch đại bằng cặp mồi ITS4 – ITS5:
                                    CCTCCGGCTTATTGATATGCTTAAGTTCAGCGGGTAGTCCTACCTGATTTGAGGTCAGAGGTCATAAAGCTGTCTTATAAGACGGTTAGAAGCTCGCCAAACGCTTCACGGTCGCGGCGTAGACATT

ATCACACCGAGAGCCGATCCGCAAGGAACCAAGCTAATGCATTTAAGAGGAGCCGACCGATAACGGCCGACAAGCCTCCAAGTCCAAGCCTACAAACCACAAAAGCTTGTAGGTTGAAGATTT

CATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATG

CGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATATAGATGTGTTACATCGCAATGCACATTCTGTTACTTTATAGAGTTTGTGATAAACGCAGGCACAGATATGCTCCGCAAGCCCGGTAAAGA

GCGTGCCTCGCAATCTGAAGCCCACAGTAAGTGCACAGGTGTAGAGTGGATGAGCAGGGCGTGCACATGCCTCGGAAGGCCAGCTACAACCCGGTCAAAACTCGATAATGATCCTTCCGCAGGT

TCACCTACGGAAACCTTGTTACGATTTTTACTTCC

So sánh với cơ sở dữ liệu trên ngân hàng gen NCBI.

Đoạn gen của mẫu PB01 dài 660bp có độ tương đồng là 99% với trình tự Ganoderma lucidum (MF476200.1) đã công bố.

2.          .3. Trình tự ITS của mẫu PB03 được khuếch đại bằng cặp mồi ITS4 – ITS5:

TTATTGATATGCTTAAGTTCAGCGGGTAGTCCTACCTGATTTGAGGTCAGAGGTCATAAAAGTTGTCTCTGGAAGCGAGACGGTTGGAAGCTCGTTCAAGGACGCTTCACGGTCGCGGCGTAAACATTAT

CACACCGACAGCCGATCCGCAAGGAATCAAGCTAATGCATTTGAGAGGAGCCGACCATTTAAAGGCCGACAAACACCTCCAAGTCCAAGCCTGCAAACCACAAAAAAAGCTTGCAGGTTGAAGATTTC

ATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGA

GCCAAGAGATCCGTTGCTGAAAGTTGTATATAGATGCGTTACATCGCAATACACATTCTGATACTTTTAAAGAGTTTGTGATAAACGCAGGCACAGACGCGCTCGACGAACAACAGCCCGCCTCGCGAT

CCATAACCCACAGTAAGTGCACAGGTGTAGAGCGGATGAGCAGGGCGTGCACATGCCTCGGAAGGCCAGCTACAACCCGGTCAAAAACTCGATAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTG

TTACGATTTTTACTTCC

So sánh với cơ sở dữ liệu trên ngân hàng gen NCBI.

Đoạn gen của mẫu PB03 dài 663bp có độ tương đồng là 99% với trình tự Ganoderma neojaponicum (AY593867.1) đã công bố.

3.      Trình tự ITS của mẫu PB04 được khuếch đại bằng cặp mồi ITS4 – ITS5:

TAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAGTTCAGCGGGTAGTCCTACCTGATTTGAGGTCAGAGGTCATAAAGGTTGTCTCTGTAACGAGACGATTAGAAGCTCGCCCAAACACGCTTCACGGTC

GCGGCGTAGACATTATCACACCGACAAGCCGATCCGCAAGGAACCAAGCTAATGCATTTAAGAGGAGCCGACCTTGTAAAGGGACCGACAAGCCTCCAAGTCCAAGCCTACAAGCCCCATAAGAAGTT

TGTAGATTGAAGATTTCATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTT

CTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATATARATGCGTTACATCGCAATACACATTCTGATACTTTATAGAGTTTGTGATAAACGCAGGCAACAAGTGCGCTCAACAAGCCCG

AATGAACGAGCCCGTTTCACGACCCGTAAACCCACAGTAAGTGCACAGGTGTAGAGTGGATGAGCAGGGCGTGCACATGCCTCGGAAGGCCAGCTACAACCCAGTCAGAACTCGATAATGATCCTTCCG

CAGGTTCACCTACGGAAACCTTGTTACGACTTTTACTTCCTCTAAATG

So sánh với cơ sở dữ liệu trên ngân hàng gen NCBI.

Đoạn gen của mẫu PB04 dài 697bp có độ tương đồng là 99% với trình tự Ganoderma gibbosum (AY593867.1) đã công bố.

Kết quả: Từ kết quả phân tích phân tử bước đầu có thể nhận định 3 mẫu nấm thu được từ VQG Phước Bình là Ganoderma lucidum (PB01), Ganoderma neojaponicum (PB03), Ganoderma gibbosum (PB04). Tuy nhiên, để định danh chính xác 3 mẫu nấm thu thập cần kết hợp với định danh hình thái dựa theo mô tả về quả thể, bào tử, cuống thân.

 

VQG Phước Bình

 Huỳnh Tấn Phi

 

Số lượt đọc: 456 - Ngày cập nhật: 17/09/2018
 Về trang trước    Bản in    Về đầu trang
Bài đã đăng:
TRANG CHỦ       GIỚI THIỆU       LIÊN HỆ
HyperLink

Vườn Quốc gia Phước Bình
Địa chỉ: Xã Phước Bình, Huyện Bác Ái, Tỉnh Ninh Thuận
Văn phòng đại diện: 8B Ngô Gia Tự, TP. Phan rang Tháp chàm, Ninh Thuận
Điện thoại: 0683.827834; Fax: 0683.826766 | Email: vqgphuocbinh@yahoo.com.vn
Website: Vqgphuocbinh.org.vn

Đang online: 9
Hôm nay: 55
Tuần này: 55
Tháng này: 158,368
Tất cả: 244,623
Designed by  Ninh Thuan Software